* . *
  • About
  • Advertise
  • Privacy & Policy
  • Contact
Wednesday, June 3, 2026
Earth-News
  • Home
  • Business
  • Entertainment

    Why Max Cady from ‘Cape Fear’ Continues to Haunt Audiences as a Timeless Nightmare

    Celebrate Pride Month 2026 with Seattle Pride in the Park and Exciting Events

    How to find free, low-cost concerts this summer in Louisville: A Q&A – The Courier-Journal

    Morgan Wallen Channels Fiery Billy Joel Vibes with Explosive Piano Flip

    Massive Fire Breaks Out at Boardman Business, Sending Thick Smoke Into the Sky

    This Hidden Entertainment Stock Is Set to Skyrocket to Record Highs

  • General
  • Health
  • News

    Cracking the Code: Why China’s Economic Challenges Aren’t Shaking Markets, Unlike America’s” – Bloomberg

    Trump’s Narrow Window to Spread the Truth About Harris

    Trump’s Narrow Window to Spread the Truth About Harris

    Israel-Gaza war live updates: Hamas leader Ismail Haniyeh assassinated in Iran, group says

    Israel-Gaza war live updates: Hamas leader Ismail Haniyeh assassinated in Iran, group says

    PAP Boss to Niger Delta Youths, Stay Away from the Protest

    PAP Boss to Niger Delta Youths, Stay Away from the Protest

    Court Restricts Protests In Lagos To Freedom, Peace Park

    Court Restricts Protests In Lagos To Freedom, Peace Park

    Fans React to Jazz Jennings’ Inspiring Weight Loss Journey

    Fans React to Jazz Jennings’ Inspiring Weight Loss Journey

    Trending Tags

    • Trump Inauguration
    • United Stated
    • White House
    • Market Stories
    • Election Results
  • Science
  • Sports
  • Technology

    Voyager Technologies CEO on acquisition of Astrobotic Technology, demand for space investment – CNBC

    Anixa Biosciences Strengthens International Patent Protection for Ovarian Cancer Vaccine Technology with Canadian Notice of Allowance – PR Newswire

    Micron Technology Surges Amid AI Boom and Market Momentum

    I Tried to Sell My House With a Chatbot – The New York Times

    Anthropic’s Partnership with the Pope on AI Harms: Genuine Collaboration or Just ‘Vatican-Washing’?

    Have Your Say: Share Your Thoughts on Technology in North Dakota Schools!

    Trending Tags

    • Nintendo Switch
    • CES 2017
    • Playstation 4 Pro
    • Mark Zuckerberg
No Result
View All Result
  • Home
  • Business
  • Entertainment

    Why Max Cady from ‘Cape Fear’ Continues to Haunt Audiences as a Timeless Nightmare

    Celebrate Pride Month 2026 with Seattle Pride in the Park and Exciting Events

    How to find free, low-cost concerts this summer in Louisville: A Q&A – The Courier-Journal

    Morgan Wallen Channels Fiery Billy Joel Vibes with Explosive Piano Flip

    Massive Fire Breaks Out at Boardman Business, Sending Thick Smoke Into the Sky

    This Hidden Entertainment Stock Is Set to Skyrocket to Record Highs

  • General
  • Health
  • News

    Cracking the Code: Why China’s Economic Challenges Aren’t Shaking Markets, Unlike America’s” – Bloomberg

    Trump’s Narrow Window to Spread the Truth About Harris

    Trump’s Narrow Window to Spread the Truth About Harris

    Israel-Gaza war live updates: Hamas leader Ismail Haniyeh assassinated in Iran, group says

    Israel-Gaza war live updates: Hamas leader Ismail Haniyeh assassinated in Iran, group says

    PAP Boss to Niger Delta Youths, Stay Away from the Protest

    PAP Boss to Niger Delta Youths, Stay Away from the Protest

    Court Restricts Protests In Lagos To Freedom, Peace Park

    Court Restricts Protests In Lagos To Freedom, Peace Park

    Fans React to Jazz Jennings’ Inspiring Weight Loss Journey

    Fans React to Jazz Jennings’ Inspiring Weight Loss Journey

    Trending Tags

    • Trump Inauguration
    • United Stated
    • White House
    • Market Stories
    • Election Results
  • Science
  • Sports
  • Technology

    Voyager Technologies CEO on acquisition of Astrobotic Technology, demand for space investment – CNBC

    Anixa Biosciences Strengthens International Patent Protection for Ovarian Cancer Vaccine Technology with Canadian Notice of Allowance – PR Newswire

    Micron Technology Surges Amid AI Boom and Market Momentum

    I Tried to Sell My House With a Chatbot – The New York Times

    Anthropic’s Partnership with the Pope on AI Harms: Genuine Collaboration or Just ‘Vatican-Washing’?

    Have Your Say: Share Your Thoughts on Technology in North Dakota Schools!

    Trending Tags

    • Nintendo Switch
    • CES 2017
    • Playstation 4 Pro
    • Mark Zuckerberg
No Result
View All Result
Earth-News
No Result
View All Result
Home Science

A palmitoyl transferase chemical–genetic system to map ZDHHC-specific S-acylation

January 8, 2024
in Science
A palmitoyl transferase chemical–genetic system to map ZDHHC-specific S-acylation
Share on FacebookShare on Twitter

Synthesis of chemical probes

Materials

All chemicals and solvents were used as received from suppliers (Sigma-Aldrich (Merck), Thermo Fisher Scientific, Fluorochem or VWR) without further purification. Gases were from British Oxygen Company (BOC) Group and ultrapure water was used for all buffers.

Instrumentation

Hydrogen-1 nuclear magnetic resonance (1H-NMR) and carbon-13 nuclear magnetic resonance (13C-NMR) spectra were recorded on Bruker AV-400 (400 MHz) spectrometer, using residual isotopic solvent as an internal reference. Chemical shifts (δ) are given in units of parts per million (ppm). Each spectrum is corrected to the solvent reference signal. The multiplicity of each signal is given by singlet (s), doublet (d), triplet (t) or multiplet (m), and the number of protons (H) associated to a peak is indicated by nH. Coupling constants (J) are given in Hz and determined by analysis using MestReNova software.

Analytical LC–MS analysis was conducted on an Acquity UPLC BDH C18 column (50 mm × 2.1 mm, i.d. 1.7 µm packing diameter) at 40 °C. Flow rate was 0.5 ml min−1 and injection volume was 1 µl. The ultraviolet detection was a summed-up signal from wavelengths between 200 and 400 nm. UPLC retention times (tr) are reported in minutes. The following elution methods were used: method 1—(gradient of H2O and MeCN, supplemented with 0.1% formic acid) 3–100% MeCN for 0–1 min, 100% MeCN for 1–3.5 min, 100% to 3% MeCN for 3.5–3.6 min, 3% MeCN for 3.6–4 min; method 2—(gradient of 25 mM ammonium acetate (pH 8.0) and MeCN) 100% MeCN for 0–5 min, 100% MeCN for 5–5.5 min, 100% to 0% MeCN for 5.5–6.5 min, 0% MeCN for 6.5–9 min.

Chromatographic purifications were performed with a Biotage Isolera 4 using c-Hex/EtOAc gradient elution system. Final compounds were purified by PREP-LCMS (Agilent Technologies, 1260 series) equipped with a liquid chromatography/mass selective detector, an Agilent prep-C18 column (5 µm particle size, 21.2 × 50 mm) using water (containing 0.1% formic acid) and acetonitrile (containing 0.1% formic acid) in a gradient with a flow of 25 ml min−1.

Synthetic methods

Synthesis of compounds was performed according to Scheme 1 in Supplementary Information.

General method A (Jones oxidation)

The corresponding alcohol 1 (6.8 mmol) was dissolved in acetone (20 ml) and cooled to 0 °C, and 20 ml of chilled Jones reagent was added dropwise. The reaction was then allowed to warm up to room temperature and monitored by thin-layer chromatography (TLC) until completion. The reaction was quenched with 10% aqueous sodium thiosulfate, extracted with Et2O, dried and evaporated to give the target compound.

General method B (esterification)

The corresponding carboxylic acid (2a-c; 1 equiv.) was dissolved in MeOH (3 ml mmol−1) and heated to reflux. Concentrated H2SO4 (59 µl mmol−1) was added, and the reaction was monitored by TLC until completion. The reaction was then quenched with dH2O, extracted with Et2O, dried and evaporated to give compound 3 as a clear oil.

General method C (secondary amine formation)

The corresponding bromo methyl ester (3a-c; 1 equiv.) and propargylamine (10 equiv.) were dissolved in acetonitrile (30 ml g−1), and the reaction was set to reflux o/n and monitored by TLC. Upon completion, the solution was concentrated, cooled down and the resulting precipitate was collected by filtration, washed with cold acetonitrile and used in the next step without further purification.

General method D (amide bond formation)

The corresponding compound (4a-c; 1 equiv.) was dissolved in dry CH2Cl2 (3 ml mmol−1) under an inert argon atmosphere. N,N-Diisopropylethylamine (DIPEA) (3 equiv.) was added, and the reaction mixture was cooled to 0 °C. The corresponding acyl chloride was added (2 equiv.). The reaction was monitored until completion, upon which it was quenched with NaHCO3. The organic layer was extracted and dried, and the residue was purified by flash chromatography over silica gel using c-Hex/EtOAc (2:1→1:1) to yield the target compound.

General method E (ester hydrolysis)

The corresponding compound (5a-i) was dissolved in THF (1.5 ml mmol−1) and treated dropwise with 1 M LiOH (5 equiv.). The reaction was monitored until completion, quenched via addition of 1 M HCl to pH 1, extracted with EtOAc, dried and evaporated to give the product usually in quantitative yield.

Methyl 12-bromododecanoate (3a)

A solution was prepared by dissolving 12-bromododecanoic acid (1.0 g, 3.58 mmol) in 12 ml of H2O. Then, 200 µl of H2SO4 was added, and the resulting solution was refluxed for 4 h. The reaction mixture was diluted with 50 ml Et2O. The layers were separated, and the organic solution was washed with NaHCO3 (aq.), H2O and brine before it was dried on Na2SO4, filtered and concentrated under reduced pressure to yield compound 3a (1.05 g, 3.4 mmol, 95%). 1H-NMR (400 MHz, chloroform-d) δ 3.66 (s, 3H), 3.40 (t, J = 6.9 Hz, 2H), 2.29 (t, J = 7.5 Hz, 2H), 1.90–1.78 (m, 2H), 1.65–1.56 (m, 2H), 1.46–1.35 (m, 2H), 1.34–1.24 (m, 12H). 13C-NMR (101 MHz, chloroform-d) δ 174.28, 51.41, 34.07, 34.01, 32.80, 29.41, 29.35, 29.19, 29.10, 28.71, 28.14 and 24.91.

Methyl 12-(prop-2-yn-1-ylamino)dodecanoate (4a)

Compound 3a (500 mg, 1.7 mmol) was dissolved in MeCN (10 ml). Propargylamine (140 mg, 2.55 mmol) and K2CO3 (469 mg, 3.4 mmol) were added, and the solution was stirred o/n at 85 °C. The reaction mixture was concentrated under reduced pressure, and the dried crude was dissolved in 50 ml EtOAc, washed with NaHCO3 (2×) and brine before it was dried on Na2SO4, filtered and concentrated under reduced pressure. The crude was purified by flash chromatography over silica gel using c-Hex/EtOAc (1:1) + 1% 7 N NH3 in MeOH to yield 4a (190 mg, 0.71 mmol, 42%). 1H-NMR (400 MHz, chloroform-d) δ 3.65 (s, 3H), 3.41 (d, J = 2.4 Hz, 2H), and 2.71–2.62 (m, 2H), 2.28 (t, J = 7.5 Hz, 2H), 2.19 (t, J = 2.4 Hz, 1H), 1.66–1.56 (m, 2H), 1.50–1.41 (m, 2H), 1.34–1.20 (m, 14H). 13C-NMR (101 MHz, chloroform-d) δ 174.25, 82.35, 71.07, 51.36, 48.71, 38.16, 34.09, 29.81, 29.51, 29.47, 29.38, 29.20, 29.11, 27.27 and 24.93.

Methyl 12-(N-(prop-2-yn-1-yl)acetamido)dodecanoate (5a)

Compound 4a (30 mg, 0.11 mmol) was dissolved in dry CH2Cl2 (2 ml). DIPEA (30 µl, 0.22 mmol) was added, and the solution was cooled on ice. Acetyl chloride (17 µl, 0.22 mmol) in 1 ml CH2Cl2 was added dropwise. The reaction mixture was stirred on ice for 4 h. The reaction was quenched with 5 ml NaHCO3 (aq.), extracted with EtOAc (3×) and the combined organic layers were dried on Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by flash chromatography over silica gel using c-Hex/EtOAc (2:1→1:1) to yield compound 5a (30 mg, 0.09 mmol, 86%). 1H- NMR (400 MHz, chloroform-d) δ 4.19 and 3.98 (d, J = 2.5 Hz, 2H), 3.65 (s, 3H), 3.38 (dt, J = 12.9, 7.5 Hz, 2H), 2.33–2.24 (m, 3H), 2.15 and 2.09 (s, 3H), 1.66–1.49 (m, 4H), 1.34–1.22 (m, 14H). 13C-NMR (101 MHz, chloroform-d) δ 174.25, 170.26, 170.00, 79.33, 72.29, 71.35, 51.39, 48.12, 46.27, 38.32, 34.09, 34.05, 29.47, 29.43, 29.36, 29.28, 29.20, 29.12, 28.42, 27.57, 26.88, 26.77, 24.94, 21.74 and 21.33.

12-(N-(Prop-2-yn-1-yl)acetamido)dodecanoic acid (6a; 16-Ac)

Compound 5a (15 mg, 0.048 mmol) was dissolved in THF (5 ml) and lithium hydroxide monohydrate (LiOH·H2O; 42 mg, 0.92 mmol) in H2O (100 µl) was added dropwise to the reaction mixture. The reaction mixture was stirred at room temperature for 4 h. The reaction was quenched with 5 ml HCl (1 M), extracted with EtOAc (3×) and the combined organic layers were washed with brine, dried on Na2SO4 and concentrated under reduced pressure. The crude product was purified by flash chromatography over silica gel using c-Hex/EtOAc (1:2→1:5) to yield compound 6a (14 mg, 0.048 mmol, quantitative). 1H-NMR (400 MHz, chloroform-d) δ 4.21 and 4.00 (d, J = 2.5 Hz, 2H), 3.40 (dt, J = 15.1, 7.6 Hz, 2H), 2.34 (t, J = 7.5 Hz, 2H), 2.28 and 2.18 (m, 1H), 2.18 and 2.12 (s, 2H), 2.20–2.15 (m, 4H), 1.38–1.24 (m, 14H). 13C-NMR (101 MHz, CDCl3) δ 178.41, 170.27, 79.24, 78.54, 77.32, 77.00, 76.68, 72.40, 71.43, 48.13, 46.36, 38.34, 34.10, 33.85, 29.42, 29.36, 29.29, 29.25, 29.20, 29.14, 28.98, 28.86, 28.38, 27.49, 26.74, 24.67, 21.68 and 21.29. In LC–MS method 1, the retention time was 1.53 min and the observed m/z calc. for C17H29NO3 (M + H)+ was 296.29, which closely matches the calculated value of 296.21.

Methyl 12-(N-(prop-2-yn-1-yl)cyclopropanecarboxamido)dodecanoate (5b)

Compound 4a (59 mg, 0.22 mmol) was dissolved in dry CH2Cl2 (2 ml). DIPEA (77 µl, 0.44 mmol) was added, and the solution was cooled on ice. Cyclopropanecarbonyl chloride (40 µl, 0.44 mmol) in 1 ml CH2Cl2 was added dropwise. The reaction mixture was stirred on ice for 4 h. The reaction was quenched with 5 ml NaHCO3 (aq.), extracted with EtOAc (3×) and the combined organic layers were dried on Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by flash chromatography over silica gel using c-Hex/EtOAc (2:1→1:1) to yield compound 5b (41 mg, 0.12 mmol, 55%). 1H-NMR (400 MHz, CDCl3) δ 4.19 (dd, J = 9.6, 2.6 Hz, 2H), 3.65 (s, 3H), 3.58–3.52 (m, 1H), 2.27 (d, J = 7.5 Hz, 2H), 1.72–1.50 (m, 5H), 1.26 (q, J = 8.0 Hz, 16H), 0.99 (qd, J = 5.3, 4.8, 1.8 Hz, 2H) and 0.77 (tt, J = 7.2, 3.3 Hz, 2H). 13C-NMR (101 MHz, CDCl3) δ 179.34, 174.34, 173.18, 79.58, 72.12, 71.28, 51.44, 47.42, 35.01, 34.09, 29.50, 29.45, 29.37, 29.32, 29.22, 29.12, 28.93, 26.85, 24.93, 20.47, 12.65, 11.20, 8.89, 7.97, 7.75 and 7.71.

12-(N-(Prop-2-yn-1-yl)cyclopropanecarboxamido)dodecanoic acid (6b; 16-cPr)

Compound 5b (41 mg, 0.12 mmol) was dissolved in THF (3 ml). In total, 610 µl of a 1 M LiOH solution in H2O was added dropwise. The reaction mixture was stirred at room temperature for 4 h. The reaction was quenched with 5 ml HCl (1 M), extracted with EtOAc (3×) and the combined organic layers were washed with brine, dried on Na2SO4 and concentrated under reduced pressure to yield compound 6b (13 mg, 0.040 mmol, 33%). 1H-NMR (400 MHz, CDCl3) δ 4.27–4.15 (m, 2H), 3.57 and 3.43 (t, J = 7.6 Hz, 1H), 2.34 (t, J = 7.5 Hz, 2H), 2.18 (d, J = 2.6 Hz, 1H), 1.83–1.51 (m, 5H), 1.40 – 1.18 (m, 14H), 1.02 (dt, J = 8.0, 4.2 Hz, 2H), 0.78 (dp, J = 7.2, 4.3 Hz, 2H). 13C-NMR (101 MHz, CDCl3) δ 178.96, 173.25, 79.58, 72.15, 71.30, 47.43, 37.61, 35.04, 33.93, 29.49, 29.41, 29.33, 29.29, 29.18, 29.01, 28.93, 27.62, 26.83, 24.68, 11.71, 11.24, 7.98 and 7.75. In LC–MS method 1, the retention time was 1.61 min and the observed m/z calc. for C19H31NO3 (M + H)+ was 322.33, which closely matches the calculated value of 322.23.

Methyl 12-(N-(prop-2-yn-1-yl)benzamido)dodecanoate (5c)

Compound 4a (59 mg, 0.22 mmol) was dissolved in dry CH2Cl2 (2 ml). DIPEA (77 µl, 0.44 mmol) was added and the solution was cooled on ice. Benzoyl chloride (51 µl, 0.44 mmol) in 1 ml CH2Cl2 was added dropwise. The reaction mixture was stirred on ice for 4 h. The reaction was quenched with 5 ml NaHCO3 (aq.), extracted with EtOAc (3×) and the combined organic layers were dried on Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by flash chromatography over silica gel using c-Hex/EtOAc (2:1→1:1) to yield compound 5c (43 mg, 0.12 mmol, 52%). 1H- NMR (400 MHz, CDCl3) δ 7.49–7.31 (m, 4H), 4.37 (s, 1H), 3.99 (s, 1H), 3.70 (s, 3H) 3.64 (s, 1H), 3.38 (s, 1H), 2.30 (td, J = 7.7, 2.6 Hz, 3H), 1.61 (tt, J = 8.0, 4.3 Hz, 4H), 1.41–1.02 (m, 14H). 13C-NMR (101 MHz, CDCl3) δ 174.28, 136.04, 129.69, 128.43, 126.78, 78.99, 51.41, 34.09, 29.44, 29.36, 29.21, 29.16, 29.12 and 24.93.

12-(N-(Prop-2-yn-1-yl)benzamido)dodecanoic acid (6c; 16-Bz)

Compound 5c (43 mg, 0.12 mmol) was dissolved in THF (3 ml). In total, 580 µl of a 1 M LiOH solution in H2O was added dropwise. The reaction mixture was stirred at room temperature for 4 h. The reaction was quenched with 5 ml HCl (1 M), extracted with EtOAc (3×) and the combined organic layers were washed with brine, dried on Na2SO4 and concentrated under reduced pressure to yield compound 6c (18 mg, 0.050 mmol, 44%). 1H-NMR (400 MHz, CDCl3) δ 7.49 (s, 1H), 7.41 (d, J = 3.9 Hz, 4H), 4.37 (s, 1H), 3.99 (s, 1H), 3.60 (s, 1H), 3.39 (s, 1H), 2.35 (t, J = 7.4 Hz, 2H), 2.29 (s, 1H), 1.64 (p, J = 7.3 Hz, 4H), 1.40 – 1.16 (m, 14H). In LC–MS method 1, the retention time was 1.66 min and the observed m/z calc. for C22H31NO3 (M + H)+ was 358.31, which closely matches the calculated value of 358.23.

Methyl 14-bromotetradecanoate (2b)

14-Bromododecan-1-ol (2.0 g, 6.8 mmol) was dissolved in acetone (50 ml). Jones reagent (10 ml) was added dropwise, and the reaction mixture was stirred for 2 h on ice. Half of the acetone was removed by rotary evaporation and H2O (50 ml) was added. The aqueous mixture was extracted with Et2O (3 × 75 ml). The combined organic layers were washed with H2O (2 × 25 ml), and brine before it was dried on Na2SO4 and concentrated under reduced pressure to yield compound 2a (2.1 g, 6.8 mmol, quantitative). 1H-NMR (400 MHz, chloroform-d) δ 3.40 (t, J = 6.9 Hz, 2H), 2.34 (t, J = 7.5 Hz, 2H), 1.85 (p, J = 7.0 Hz, 2H), 1.63 (q, J = 7.3 Hz, 2H), 1.43–1.26 (m, 20H). 13C-NMR (101 MHz, CDCl3) δ 180.15, 77.32, 77.00, 76.68, 34.40, 34.04, 33.95, 32.83, 29.52, 29.48, 29.40, 29.37, 29.19, 29.02, 28.74, 28.16, 25.00 and 24.64.

Methyl 14-bromotetradecanoate (3b)

Compound 2a (1.0 g, 3.4 mmol) was dissolved in dry MeOH (10 ml), H2SO4 (200 µl) was added and the mixture was stirred at 75 °C for 2 h. The mixture was then concentrated under reduced pressure until ~80% of the MeOH was evaporated. Water (50 ml) was added, and the aqueous mixture was extracted with Et2O (3×). The combined organic layers were washed with NaHCO3 (aq.), and brine before it was dried on Na2SO4, filtered and concentrated under reduced pressure to yield compound 3b (1.05 g, 3.4 mmol, quantitative). 1H-NMR (400 MHz, chloroform-d) δ 3.65 (s, 3H), 3.39 (t, J = 6.9 Hz, 2H), 2.28 (t, J = 7.5 Hz, 2H), 1.84 (dt, J = 14.4, 6.9 Hz, 2H), 1.61 (q, J = 7.4 Hz, 2H), 1.45–1.34 (m, 2H), 1.33–1.20 (m, 18H). 13C-NMR (101 MHz, CDCl3) δ 174.23, 77.32, 77.00, 76.68, 51.34, 34.06, 33.90, 32.81, 29.50, 29.46, 29.37, 29.19, 29.10, 28.71, 28.13, 25.71 and 24.91.

Methyl 14-(Prop-2-yn-1-ylamino)tetradecanoate (4b)

Compound 3b (0.5 g, 1.63 mmol) was dissolved in MeCN (15 ml), propargylamine (1.05 ml, 16.3 mmol) was added and the reaction mixture was stirred at 85 °C o/n. The solution was concentrated to ~4 ml, and the precipitate was collected by filtration. The filtrate was washed with cold MeCN to yield compound 4b (280 mg, 95 mmol, 58%). 1H-NMR (400 MHz, CDCl3) δ 3.86 (d, J = 2.6 Hz, 2H), 3.66 (s, 3H), 3.18–3.04 (m, 2H), 2.59 (t, J = 2.6 Hz, 1H), 2.30 (t, J = 7.6 Hz, 2H), 1.90 (p, J = 7.7 Hz, 2H), 1.61 (t, J = 7.3 Hz, 2H), 1.47–1.18 (m, 18H). 13C-NMR (101 MHz, CDCl3) δ 174.36, 78.44, 77.32, 77.00, 76.68, 72.43, 51.44, 46.26, 35.97, 34.11, 29.52, 29.46, 29.40, 29.35, 29.23, 29.13, 28.95, 26.75, 25.72 and 24.94.

14-(N-(Prop-2-yn-1-yl)acetamido)tetradecanoic acid (6d; 18-Ac)

Compound 4b (60 mg, 0.2 mmol) was dissolved in dry CH2Cl2 (5 ml). Acetyl chloride (21 µl, 0.3 mmol) was added, and the solution was cooled on ice. DIPEA (41 µl, 0.3 mmol) in CH2Cl2 (1 ml) was added dropwise. The reaction mixture was stirred for 2 h before NaHCO3 (5 ml) was added. The layers were separated, and the aqueous layer was extracted with CH2Cl2. The combined organic layers were washed with brine, dried on MgSO4 and concentrated under reduced pressure. The residue was purified by flash chromatography over silica gel using c-Hex/EtOAc (2:1→1:3) to yield compound 5d (50 mg, 0.015 mmol, 75%). Compound 5d was used directly for ester hydrolysis without further purification.

Compound 5d (40 mg, 0. 11 mmol) was dissolved in THF (5 ml). In total, 1.2 ml of a 1 M LiOH solution in H2O was added dropwise. The reaction mixture was stirred at room temperature o/n. The reaction was quenched with 5 ml HCl (1 M), extracted with EtOAc (3×) and the combined organic layers were washed with brine, dried on Na2SO4 and concentrated under reduced pressure. The residue was purified by flash chromatography over silica gel using c-Hex/EtOAc (1:2→1:5) to yield compound 6d (25 mg, 0.077 mmol, 70%). 1H-NMR (400 MHz, CDCl3) δ 4.20 and 3.99 (d, J = 2.5 Hz, 2H), 3.46–3.34 (m, 2H), 2.33 (t, J = 7.5 Hz, 2H), 2.18 and 2.12 (m, 4H), 1.68–1.50 (m, 4H), 1.37–1.22 (m, 18H). 13C-NMR (101 MHz, CDCl3) δ 178.93, 178.84, 170.69, 170.35, 79.17, 78.61, 77.32, 77.00, 76.68, 72.41, 71.44, 48.14, 46.37, 38.34, 34.10, 33.98, 29.67, 29.50, 29.48, 29.45, 29.44, 29.39, 29.35, 29.29, 29.25, 29.19, 29.10, 29.02, 28.97, 28.34, 27.48, 26.81, 26.72, 24.69, 21.66 and 21.26. In LC–MS method 1, the retention time was 1.67 min and the observed m/z calc. for C19H33NO3 (M + H)+ was 324.27, which closely matches the calculated value of 324.26.

14-(N-(Prop-2-yn-1-yl)cyclopropanecarboxamido)tetradecanoic acid (6e; 18-cPr)

Compound 4b (40 mg, 0.13 mmol) was dissolved in dry CH2Cl2 (4 ml). Cyclopropanecarbonyl chloride (24 µl, 0.26 mmol) was added, and the solution was cooled on ice. DIPEA (45 µl, 0.26 mmol) in CH2Cl2 (1 ml) was added dropwise. The reaction mixture was stirred for 2 h before NaHCO3 (5 ml) was added. The layers were separated, and the aqueous layer was extracted with CH2Cl2. The combined organic layers were washed with brine, dried on MgSO4 and concentrated under reduced pressure. The residue was purified by flash chromatography over silica gel using petroleum ether/EtOAc (2:1→1:3) to yield compound 5e (41 mg, 0.112 mmol, 92%). Compound 5e was used directly for ester hydrolysis without further purification.

Compound 5e (41 mg, 0.112 mmol) was dissolved in THF (5 ml). In total, 1.2 ml of a 1 M LiOH solution in H2O was added dropwise. The reaction mixture was stirred at room temperature o/n. The reaction was quenched with 5 ml HCl (1 M), extracted with EtOAc (3×) and the combined organic layers were washed with brine, dried on Na2SO4 and concentrated under reduced pressure. The residue was purified by flash chromatography over silica gel using c-Hex/EtOAc (1:2→1:5) to yield compound 6e (31 mg, 0.088 mmol, 68%). 1H-NMR (400 MHz, CDCl3) δ 4.22 and 4.19 (d, 2.6 Hz, 2H), 3.56 and 3.42 (t, J = 7.6 Hz, 2H), 2.33 (t, J = 7.5 Hz, 2H), 2.29 and 2.17 (s, 1H), 1.83–1.49 (m, 5H), 1.37–1.20 (m, 18H), 1.04–0.97 (m, 2H), 0.82–0.74 (m, 2H). 13C-NMR (101 MHz, CDCl3) δ 179.26, 173.29, 79.56, 77.35, 77.04, 76.72, 72.16, 71.31, 47.45, 47.11, 37.62, 35.05, 34.01, 29.56, 29.53, 29.51, 29.39, 29.33, 29.23, 29.15, 29.05, 28.93, 27.66, 26.86, 24.71, 11.71, 11.24, 8.00 and 7.77. In LC–MS method 1, the retention time was 1.72 min and the observed m/z calc. for C21H35NO3 (M + H)+ was 350.36, which closely matches the calculated value of found 350.26.

14-(N-(Prop-2-yn-1-yl)benzamido)tetradecanoic acid (6f; 18-Bz)

Compound 4b (85 mg, 0.29 mmol) was dissolved in dry CH2Cl2 (4 ml). Benzoyl chloride (31 µl, 0.29 mmol) was added, and the solution was cooled on ice. DIPEA (101 µl, 0.58 mmol) in CH2Cl2 (1 ml) was added dropwise. The reaction mixture was stirred for 2 h before NaHCO3 (5 ml) was added. The layers were separated, and the aqueous layer was extracted with CH2Cl2. The combined organic layers were washed with brine, dried on MgSO4 and concentrated under reduced pressure. The residue was purified by flash chromatography over silica gel using c-Hex/EtOAc (2:1→1:3) to yield compound 5f (68 mg, 0.17 mmol, 59%). Compound 5f was used directly for the ester hydrolysis without further purification.

Compound 5f (40 mg, 0.112 mmol) was dissolved in THF (5 ml). In total, 1.2 ml of a 1 M LiOH solution in H2O was added dropwise. The reaction mixture was stirred at room temperature o/n. The reaction was quenched with 5 ml HCl (1 M), extracted with EtOAc (3×) and the combined organic layers were washed with brine, dried on Na2SO4 and concentrated under reduced pressure. The residue was purified by flash chromatography over silica gel using c-Hex/EtOAc (1:2→1:5) to yield compound 6f (28 mg, 0.072 mmol, 67%). 1H-NMR (400 MHz, CDCl3) δ 7.48 (s, 1H), 7.41 (s, 4H), 4.37 (s, 1H), 3.98 (s, 1H), 3.60 (s, 1H), 3.37 (s, 1H), 2.33 (t, J = 7.5 Hz, 2H), 2.28 (s, 1H), 1.72–1.50 (m, 4H), 1.43–1.10 (m, 18H). 13C-NMR (101 MHz, CDCl3) δ 179.40, 135.91, 129.70, 128.46, 126.81, 78.92, 72.42, 71.95, 34.05, 29.53, 29.52, 29.39, 29.21, 29.05 and 24.71. In LC–MS method 1, the retention time was 1.66 min and the observed m/z calc. for C24H35NO3 (M + H)+ was 386.35, which closely matches the calculated value of 386.26.

Methyl 16-(prop-2-yn-1-ylamino)hexadecanoate (4c)

Methyl 16-bromohexadecanoate (0.5 g, 1.43 mmol) was dissolved in MeCN (15 ml), propargylamine (916 µl, 14.3 mmol) was added and the reaction mixture was stirred at 85 °C o/n. The solution was concentrated, cooled down and the resulting precipitate was collected by filtration, then washed with cold MeCN to yield compound 4c (391 mg, 1.21 mmol, 85%). 1H-NMR (400 MHz, CDCl3) δ 3.86 (d, J = 2.6 Hz, 2H), 3.67 (s, 3H), 3.17–3.09 (m, 2H), 2.59 (t, J = 2.6 Hz, 1H), 2.30 (t, J = 7.6 Hz, 2H), 1.89 (q, J = 7.9 Hz, 2H), 1.61 (d, J = 7.4 Hz, 2H), 1.41 (t, J = 7.7 Hz, 2H), 1.35–1.23 (m, 22H). 13C-NMR (101 MHz, CDCl3) δ 174.39, 78.38, 72.54, 51.46, 46.31, 35.99, 34.14, 29.63, 29.59, 29.51, 29.45, 29.39, 29.27, 29.17, 29.00, 26.79, 25.81 and 24.97.

16-(N-(Prop-2-yn-1-yl)acetamido)hexadecanoic acid (6g; 20-Ac)

Compound 4c (50 mg, 0.15 mmol) was dissolved in dry CH2Cl2 (3 ml). Acetyl chloride (21 µl, 0.3 mmol) was added, and the solution was cooled on ice. DIPEA (54 µl, 0.3 mmol) in CH2Cl2 (1 ml) was added dropwise. The reaction mixture was stirred for 2 h before NaHCO3 (5 ml) was added. The layers were separated, and the aqueous layer was extracted with CH2Cl2. The combined organic layers were washed with brine, dried on MgSO4 and concentrated under reduced pressure. The residue was purified by flash chromatography over silica gel using c-Hex/EtOAc (2:1→1:3) to yield compound 5g (10 mg, 0.027 mmol, 18%).

Compound 5g (10 mg, 0.027 mmol) was dissolved in THF (1 ml). In total, 140 µl of a 1 M LiOH solution in H2O was added dropwise. The reaction mixture was stirred at room temperature for 4 h. The reaction was quenched with 1 ml HCl (1 M), extracted with EtOAc (3×) and the combined organic layers were washed with brine, dried on Na2SO4 and concentrated under reduced pressure to yield compound 6g (6 mg, 0.017 mmol, 60%). 1H-NMR (400 MHz, CDCl3) δ 4.21 (d, J = 2.5 Hz, 2H), 4.00 (d, J = 2.5 Hz, 1H), 3.41–3.34 (m, 2H), 2.18 (d, J = 1.9 Hz, 2H), 2.12 (s, 3H), 1.62 (q, J = 7.3 Hz, 4H), 1.26 (d, J = 2.9 Hz, 22H). 13C-NMR (101 MHz, CDCl3) δ 178.09, 169.78, 72.40, 71.43, 48.15, 38.36, 34.09, 29.57, 29.28, 29.22, 26.74, 24.72, 21.33. In LC–MS method 1, the retention time was 1.61 min and the observed m/z calc. for C21H37NO3 (M + H)+ was 352.36, which closely matches the calculated value of 352.28.

Methyl 16-(N-(prop-2-yn-1-yl)cyclopropanecarboxamido)hexadecanoate (5h)

Compound 4c (90 mg, 0.28 mmol) was dissolved in dry CH2Cl2 (5 ml). Cyclopropanecarbonyl chloride (50 µl, 0.56 mmol) was added, and the solution was cooled on ice. DIPEA (97 µl, 0.56 mmol) in CH2Cl2 (1 ml) was added dropwise. The reaction mixture was stirred for 2 h before NaHCO3 (5 ml) was added. The layers were separated, and the aqueous layer was extracted with CH2Cl2. The combined organic layers were washed with brine, dried on MgSO4 and concentrated under reduced pressure. The residue was purified by flash chromatography over silica gel using c-Hex/EtOAc (2:1→1:3) to yield compound 5h (53 mg, 0.14 mmol, 49%). 1H-NMR (400 MHz, CDCl3) δ 4.26–4.19 (m, 2H), 3.68 (s, 3H), 3.57 (d, J = 7.8 Hz, 1H), 2.32 (t, J = 7.5 Hz, 2H), 1.77–1.56 (m, 5H), 1.29 (d, J = 11.8 Hz, 23H), 1.03 (dq, J = 8.5, 4.5, 3.7 Hz, 2H), 0.80 (dt, J = 7.8, 3.4 Hz, 2H). 13C-NMR (101 MHz, CDCl3) δ 174.36, 173.13, 79.64, 71.24, 51.45, 47.41, 34.98, 34.13, 29.64, 29.59, 29.57, 29.45, 29.35, 29.26, 29.16, 28.95, 26.87, 24.97, 11.20, 7.96 and 7.70.

16-(N-(Prop-2-yn-1-yl)cyclopropanecarboxamido)hexadecanoic acid (6h; 20-cPr)

Compound 5h (53 mg, 0.14 mmol) was dissolved in THF (3 ml). In total, 700 µl of a 1 M LiOH solution in H2O was added dropwise. The reaction mixture was stirred at room temperature for 4 h. The reaction was quenched with 1 ml HCl (1 M), extracted with EtOAc (3×) and the combined organic layers were washed with brine, dried on Na2SO4 and concentrated under reduced pressure to yield compound 6h (32 mg, 0.085 mmol, 61%). 1H-NMR (400 MHz, CDCl3) δ 4.21 (dd, J = 11.6, 2.5 Hz, 2H), 3.60–3.51 (m, 1H), 3.43 (t, J = 7.6 Hz, 1H), 2.34 (t, J = 7.5 Hz, 2H), 2.18 (t, J = 2.5 Hz, 1H), 1.85–1.56 (m, 5H), 1.36–1.24 (m, 22H), 1.01 (td, J = 6.3, 5.4, 2.7 Hz, 2H), 0.78 (dt, J = 7.9, 3.4 Hz, 2H). 13C-NMR (101 MHz, CDCl3) δ 178.88, 173.24, 79.59, 72.13, 71.29, 47.44, 35.03, 33.92, 29.61, 29.54, 29.42, 29.34, 29.24, 29.06, 28.93, 26.86, 24.71, 11.24, 8.00 and 7.76. In LC–MS method 1, the retention time was 1.61 min and the observed m/z calc. for C23H39NO3 (M + H)+ was 378.40, which closely matches the calculated value of 378.29.

16-(N-(Prop-2-yn-1-yl)benzamido)hexadecanoic acid (6i; 20-Bz)

Compound 4c (70 mg, 0.22 mmol) was dissolved in dry CH2Cl2 (2 ml). Benzoyl chloride (50 µl, 0.44 mmol) was added, and the solution was cooled on ice. DIPEA (76 µl, 0.44 mmol) in CH2Cl2 (1 ml) was added dropwise. The reaction mixture was stirred for 2 h before NaHCO3 (5 ml) was added. The layers were separated, and the aqueous layer was extracted with CH2Cl2. The combined organic layers were washed with brine, dried on MgSO4 and concentrated under reduced pressure. The residue was purified by flash chromatography over silica gel using c-Hex/EtOAc (2:1→1:3) to yield compound 5i (58 mg, 0.14 mmol, 63%). Compound 5i (40 mg, 0.094 mmol) was dissolved in THF (3 ml). In total, 470 µl of a 1 M LiOH solution in H2O was added dropwise. The reaction mixture was stirred at room temperature for 4 h. The reaction was quenched with 1 ml HCl (1 M), extracted with EtOAc (3×) and the combined organic layers were washed with brine, dried on Na2SO4 and concentrated under reduced pressure to yield compound 6i (12 mg, 0.029 mmol, 31%). 1H-NMR (400 MHz, CDCl3) δ 7.48 (s, 1H), 7.41 (d, J = 3.6 Hz, 4H), 4.37 (s, 1H), 3.99 (s, 1H), 3.61 (s, 1H), 3.37 (s, 1H), 2.33 (t, J = 7.5 Hz, 2H), 2.28 (s, 1H), 1.62 (p, J = 7.4 Hz, 4H), 1.30–1.14 (m, 20H). 13C-NMR (101 MHz, CDCl3) δ 179.62, 136.39, 130.20, 128.90, 127.25, 79.42, 72.26, 34.43, 30.05, 30.03, 29.99, 29.85, 29.67, 29.50 and 25.16. In LC–MS method 1, the retention time was 1.86 min and observed m/z calc. for C26H39NO3 (M + H)+ was 414.34, which closely matches the calculated value of 414.29.

C18-Bz-CoA probe

To a suspension of 14-(N-(prop-2-yn-1-yl)benzamido)tetradecanoic acid (30 mg, 78 μmol, 2 equiv.) in dry THF (1.2 ml) was added a solution of 1,1′-carbonyl-diimidazole (15 mg, 94 μmol, 2.4 equiv.) in CH2Cl2 (1.2 ml), under nitrogen atmosphere. The clear reaction mixture was stirred for 45 min at room temperature. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in dry THF (1.2 ml). Coenzyme A hydrate (30 mg, 39 μmol, 1 equiv.) was dissolved in an aqueous solution of NaHCO3 (0.5 M, 4 ml) and added dropwise to the solution of activated acid. The reaction mixture was stirred at room temperature for 3 h under nitrogen atmosphere, flash frozen in liquid N2 and lyophilized overnight. The samples were then dissolved in 1 ml H2O, and the product was purified by preparative RP-HPLC over a gradient of 25 mM ammonium acetate pH 8 in MeCN. C18-Bz-CoA 19 was obtained as a white lyophilized solid (22 mg, 47% yield). 1H-NMR (400 MHz, D2O) δ 8.51 (s, 1H), 8.20 (s, 1H), 7.35 (dd, J = 13.8, 7.6 Hz, 4H), 7.27 (d, J = 7.4 Hz, 1H), 6.08 (d, J = 6.1 Hz, 1H), 4.80–4.70 (m, 2H), 4.53 (p, J = 2.8 Hz, 1H), 4.23–4.16 (m, 2H), 3.98 (s, 1H), 3.84 (dd, J = 9.8, 5.0 Hz, 1H), 3.52 (dd, J = 9.8, 4.7 Hz, 1H), 3.37 (p, J = 6.7 Hz, 2H), 3.22 (dtd, J = 11.1, 7.8, 7.3, 3.4 Hz, 4H), 2.89 (t, J = 6.7 Hz, 2H), 2.64 (d, J = 2.5 Hz, 1H), 2.42 (t, J = 7.4 Hz, 2H), 2.35 (t, J = 6.9 Hz, 2H), 1.44 (p, J = 7.3 Hz, 4H), 1.14–0.91 (m, 18H), 0.87 (s, 3H), 0.70 (s, 3H). 13C-NMR (151 MHz, D2O) δ 174.65, 173.41, 148.71, 140.74, 134.73, 128.69, 126.36, 118.34, 86.96, 82.43, 78.89, 74.06, 73.91, 65.16, 50.96, 43.67, 38.72, 38.44, 38.39, 35.47, 35.37, 29.32, 29.16, 28.98, 28.57, 27.99, 25.36, 21.05 and 18.13. In LC–MS method 2, the retention time was 4.39 min and observed m/z calc. for C45H69N8O18P3S (M + H) + was 1135.5, which closely matches the calculated value of 1135.37.

Cell culture and compound preparation

HEK293T, HEK293-FT, MDA-MB-231 and PANC1 cell lines were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with GlutaMAX (Thermo Fisher Scientific, 10566016), 10% vol/vol FBS, 100 U ml−1 penicillin and 0.1 mg ml−1 streptomycin (Thermo Fisher Scientific, 15140122) in a 37 °C, 5% CO2 incubator. Cells were selected with puromycin dihydrochloride (Thermo Fisher Scientific, A1113803), blasticidin S hydrochloride (Thermo Fisher Scientific, A1113903) and hygromycin B (Thermo Fisher Scientific, 10687010) at final concentrations noted below. Synthetic lipid-based loading and transfer probes and alkyne palmitic acid (2BScientific, BCAL-015-25), palmostatin B (Sigma-Aldrich, 178501), TAMRA or biotin PEG3 azide (Sigma-Aldrich, 760757 or 762024), tris((1-benzyl-1H-1,2,3-triazol-4-yl)methyl)amine (TBTA; Sigma-Aldrich, 678937) and palmitoyl coenzyme A (Sigma-Aldrich, P9716; ≥90%) were dissolved in DMSO and stored at −20 °C. Sealed ampules containing a 0.5 M aqueous solution of tris (2-carboxyethyl) phosphine (TCEP) and TCEP HCl (C4706) were purchased from Sigma-Aldrich, and n-dodecyl-β-d-maltopyranoside (DDM) was purchased from Generon (D310LA). TCEP HCl was prepared fresh as 50 mM stock in Milli-Q H2O, DDM was prepared as a 10% stock solution in Milli-Q H2O and stored at −20 °C and cOmplete, EDTA-free protease inhibitor cocktail tablets were used according to the manufacturer’s instructions (Sigma-Aldrich, 11873580001).

Antibodies and western analysis

Mouse-derived monoclonal antibodies for FLAG M2 (F1804), HA-epitope (HA-7, H3663) and α-tubulin (T5168) and rabbit-derived polyclonal antibodies for ZDHHC20 (Atlas Antibodies, HPA014702), BCAP31 (Atlas Antibodies, HPA003906) and V5-epitope (SAB1306079) were purchased from Sigma-Aldrich. Mouse monoclonal anti-GFP (GF28R) antibody was purchased from Generon, rabbit monoclonal anti-TOMM20 (ab186735) antibody was purchased from Abcam, rabbit polyclonal anti-TMX1 (HPA003085) antibody was purchased from Atlas Antibodies, rabbit polyclonal anti-NCAM1/CD56 (14255-1-AP) and anti-PI4K2A (15318-1-AP) antibodies were bought from ProteinTech and rabbit-derived polyclonal antibodies against vinculin (42H89L44) and calnexin (ab22595) were purchased from Thermo Fisher Scientific and Abcam, respectively. Secondary antibodies were horseradish peroxidase (HRP)-conjugated, polyclonal goat-derived antibodies against mouse (Dako, P0447) and rabbit (Dako, P0448), or fluorophore-conjugated IRDye 680CW goat anti-mouse (Licor, 926-68072) and IRDye 680CW goat anti-rabbit (Licor, 926-32211). Western blot analysis was accomplished through SDS–PAGE of cell lysates or affinity-resin eluates in 1× Laemmli loading buffer (Bio-Rad, 1610747) containing 2.5% β-mercaptoethanol and transfer of protein onto polyvinylidene fluoride (PVDF) or nitrocellulose using the Trans-Blot Turbo System (Bio-Rad). Secondary HRP-conjugates were visualized after addition of Clarity Western ECL Substrate (Bio-Rad, 1705061) and chemiluminescent detection in an Amersham Imager 680 (GE Life Sciences) or fluorescence detection using a LICOR Odyssey CLx. Quantitation of western blot protein intensity was performed by densitometry using ImageJ 1.50c or Image Studio Lite (GE Life Sciences), and data were plotted using Prism 9.0.

ZDHHC structural modeling

Human ZDHHC family protein sequences were aligned using the ‘Create Alignment’ module of CLC Sequence Viewer 7. Regions of sequence similarity that also overlap with ZDHHC20 transmembrane helices (TMs) 1–4 and the DHHC-containing cysteine-rich domain were identified and selected for homology modeling. To generate homology models for ZDHHCs 1–19 and 21–24, selected sequences were individually submitted to the Protein Homology/analogY Recognition Engine V 2.0 (Phyre2) using the ‘Normal’ modeling mode55. To identify putative bump-hole mutations, homology models were structurally aligned to the ZDHHC20-2BP crystal structure (Protein Data Bank (PDB) ID: 6BML) using MacPyMOL: PyMOL V1.5.0.4. Residues located on TM3 and spatially overlapping with or proximal to ZDHHC20-Y181 were prioritized for bump-hole analysis; however, several ZDHHC models did not present residues meeting these criteria. In this case, strict rules were adopted including (1) selection of ZDHHC20-Y181 or (2) -F65 proximal residues located on TMs 2 and 3 overlapping with ZDHHC20 residues having B-factor values 70 was required for feature matching, with the contribution to overall score set as follows: mass score 100, isotope abundance score 60, isotope spacing score 50 and retention time score 100. Features over 20% of the saturation limit were excluded from the dataset. Matched features were manually inspected and re-integrated where required and checked for the correct adduct pattern for the relevant lipid class. Data were exported as .csv files containing the identity, peak area and the retention time of each lipid species. Further data analysis and data representation were performed in Excel and GraphPad Prism. The relative abundance of each lipid species within a class was calculated as a percentage of the summed peak areas of all species identified within the class. Triglyceride (TG) species were quantified from data acquired in positive mode, while all other species were quantified from data acquired in negative mode (n = 5 for each experimental condition).

Assignment of probe-derived lipids

Feature extraction of data acquired in MS mode was carried out in Mass Hunter Profinder (v. 10.0, Agilent Technologies) using the ‘Batch Recursive Feature Extraction (small molecule/peptide)’ option. Samples were grouped according to experimental conditions. All parameters except those detailed below were used as preset by the program. Peak heights were set to a minimum of 3,000 counts. H+, Na+ and NH4+ adducts were selected for positive mode, and H−, C2H3O2− and CHO2− adducts were selected for negative mode. For compound binning and alignment, retention time tolerance was set to (±0% + 0.15 min) and mass tolerance to (±5 ppm + 2 mDa). A minimum free energy score of at least 70 was required in at least 4 of 6 samples per group. For match tolerance, the mass was set to ±10 ppm and retention time to ±0.15 min. The EIC extraction range was limited to ±0.15 min of the expected retention time. An overall score of>75 was required for feature matching, with the contribution to the overall score set as follows: mass score 100, isotope abundance score 60, isotope spacing score 50 and retention time score 100. Features over 20% of the saturation limit were excluded from the dataset. Postprocessing filters were set to require a score (Tgt) of at least 50 in 4 of 6 samples per experimental group.

Manual filtering was performed to remove features present in the blank extraction samples. To create a list of features originating from probe metabolism, only features unique to each probe condition were selected. All features present in DMSO control samples were discarded. Features were manually inspected and re-integrated where required. The feature lists were used to create inclusion lists for MS/MS analysis and peak lists for lipid annotations as described below.

LipidMatch (v. 3.5)61 was used for assignment of probe-derived lipids. Lipid libraries containing theoretical fragments of probe-derived lipid species of different classes (PC, PE, PC-O, PE-O, PC-P, PE-P, Cer-NS, Cer-NDS, diglyceride (DG) and TG) were constructed and added to the existing library folder. Agilent .d files were converted to .ms2 format using MSConvertGUI (ProteoWizard)62. The search was performed using the feature tables created above. Search parameters were set as follows: retention time window, ±0.15 min; ppm window for matching experimental and in silico fragments, ±5 ppm; mass accuracy window for matching experimental and in silico precursors, ±0.005 Da; MS/MS isolation window, 1 Da; minimum signal intensity for MS/MS ion, 1; minimum number of scans for confirmation, 1. All lipid assignments were manually curated by inspecting MS/MS spectra and ensuring correct adduct formation for the relevant lipid class. Additionally, a small number of lipids were assigned manually from MS/MS spectra. The retention time of all probe-derived lipid species matched the expected retention time window for the relevant lipid class. Note that in contrast to natural DG and TG species, which preferentially form NH4+ and Na+ adducts, probed-derived DG and TG species preferentially formed the (M + H)+ ion, presumably through protonation at the amide moiety.

Quantitative MS-based proteomics

On-bead hydrolysis proteomics

Cells were concurrently plated and transfected with 1 µg ml−1 of the appropriate ZDHHC construct using 3 µl of FuGene per 1 µg of DNA in a 10 cm dish. After 6 h, the media was refreshed and cells were incubated overnight. Cells were treated with 15 µM of the appropriate probe in 0.5% FBS media for 8 h. Cells were then washed 3× with ice-cold PBS then lysed in SDS lysis buffer (50 mM HEPES (pH 7.4), 0.5% NP-40, 0.25% SDS, 10 mM NaCl, 2 mM MgCl2, EDTA-free cOmplete protease inhibitor (Roche,11873580001) and 0.05 U μl−1 benzonase (Merck, E1014). Lysates were adjusted to 2 mg ml−1, using ~2 mg per condition, and then subjected to a click reaction using biotin-PEG3-azide as described above before EDTA quenching followed by chloroform/methanol precipitation.

For those samples where no site ID was performed, protein samples were suspended in 50 mM HEPES (pH 7.4) containing 1% SDS and then precipitated with chloroform/methanol. For experiments including site identification of lipidation, proteins were solubilized in 1 ml 50 mM triethanolamine (pH 7.5), 4% SDS and 5 mM EDTA. TCEP (10 mM) was added to samples and incubated for 20 min at room temperature with agitation. To these solutions, 25 mM N-ethylmaleimide (NEM, from 1 M stock in EtOH) was added and incubated for 2 h at room temperature with agitation. Samples were then precipitated with chloroform/methanol.

All protein samples were then suspended in 50 mM HEPES (pH 7.4) containing 2% SDS and then diluted to 0.2% SDS using 50 mM HEPES (pH 7.4). Labeled proteins were enriched using NeutrAvidin agarose beads (Thermo Fisher Scientific, 29200) using 40 μl (50% slurry) per condition. Beads were washed with 0.2% SDS in 50 mM HEPES (pH 7.4) before incubation with the samples for 3 h at room temperature with agitation. Beads were then washed 2× with 0.2% SDS in 50 mM HEPES (pH 7.4) and 4× with 50 mM HEPES (pH 7.4). Beads were then suspended in 20 µl of 50 mM triethanolamine (pH 7.5), 4 mM EDTA and 0.5% ProteaseMAX (Promega, V2071). To this was added 10 µl of the NH2OH cleavage solution (100 µl of 8.16 M NH2OH in 50 mM TEA (pH 8.0), 30 µl of 500 mM triethanolamine (pH 7.5), 2.6 µl of 500 mM EDTA and 197.4 µl water) giving a final NH2OH concentration of 0.82 M, and the samples were incubated at room temperature for 2 h with agitation. Following this, 100 µl of 50 mM HEPES (pH 8.0) containing 5 mM TCEP was added, the beads were pelleted and 120 µl of supernatant was taken. In total, 20 mM chloroacetamide was added to the supernatant, and they were incubated at room temperature for 15 min. Samples were then diluted with 400 µl HEPES (50 mM, pH 8.0) and digested with 0.3 µg of trypsin (Promega, V5111) o/n at 37 °C. Samples were acidified with 0.5% (vol/vol) trifluoroacetic acid (TFA), flash frozen and lyophilized. Samples were dissolved in water containing 0.5% TFA and loaded onto stage tips containing three polystyrenedivinyl-benzene (SDB-XC) copolymer discs (Merck, 66884-U). The stage tipping procedure was carried out as described in ref. 63. Peptide samples were eluted in 55% acetonitrile in water, and the solvent was removed by incubation in an Eppendorf Concentrator plus at 45 °C.

Samples in which site ID was not performed were dissolved in water containing 0.1% TFA, ready for LC–MS/MS analysis. For samples where site ID was performed, before LC–MS/MS analysis samples were 3× SCX fractionation using stage tips loaded with three layers SDB–RPS discs (3M Empore). Peptides were loaded on the solid phase in 0.5% TFA and subsequently washed 3× with 60 µl 0.2% TFA. Peptides were eluted using the following three elution buffers (60 µl): buffer 1 (100 mM ammonium formate, 40% (vol/vol) MeCN, 0.5% (vol/vol) formic acid), buffer 2 (150 mM ammonium formate, 60% (vol/vol) MeCN, 0.5% (vol/vol) formic acid) and buffer 3 (5% (vol/vol) ammonium hydroxide, 80% (vol/vol) MeCN). Samples were dried in an Eppendorf Concentrator plus at 45 °C and then dissolved in water containing 0.1% TFA, ready for LC–MS/MS analysis. Peptides were analyzed on a Q-Exactive mass spectrometer (Thermo Fisher Scientific) coupled to an Ultimate 3000 LC (Thermo Fisher Scientific) using an Easy Spray Nano-source. The instrument was operated in data-dependent acquisition mode selecting the ten most intense precursor ions for fragmentation.

YnPal KO proteomics

A total of 6 × 106 cells from HEK293T, HEK293T ZDHHC20 CRISPR knockdown cell line and two HEK293T ZDHHC20 CRISPR KO clonal lines were seeded in triplicate into 10 cm dishes and left o/n at 37 °C. Cells were then treated with 15 μM YnPal or 15 μM palmitic acid and incubated for 8 h at 37 °C. Cells were then washed 3× with PBS and then lysed in SDS lysis buffer. Lysates were adjusted to 2 mg ml−1, using 2 mg per condition, and then subjected to a click reaction using biotin-PEG3-azide as described above. The reaction was quenched with 5 mM EDTA followed by chloroform/methanol precipitation. Protein pellets were washed and sonicated 2× with 1 ml MeOH, and samples were processed via on-bead digestion.

YnPal ZDHHC20 proteomics

Cells were transfected as described above and then left overnight. Cells were then treated with 25 µM YnPal in full media for 4 h. Cells were then washed 3× with ice-cold PBS, lysed in SDS lysis buffer, spun at 14 kG for 10 min at 4 °C and then the clarified lysates were equalized and adjusted to 2 mg ml−1. Lysates were clicked as described above using biotin-PEG3-azide, quenched with EDTA and then precipitated using methanol/chloroform. Samples were processed as described for on-bead digestion with the following addition. Samples were dissolved in 1% SDS, 150 mM NaCl, 1 mM EDTA and 50 mM HEPES (pH 7). Samples were then diluted with buffer or buffer plus neutralized NH2OH to a concentration of 1 M and were then shaken at room temperature for 1 h. Samples were precipitated using methanol/chloroform; then dissolved again in 1% SDS, 150 mM NaCl, 1 mM EDTA, and 50 mM HEPES (pH 7); then diluted with buffer or buffer plus neutralized NH2OH to a concentration of 0.66 M and then heated to 90 °C for 5 min. Samples were precipitated using methanol/chloroform then followed by the methodology described in the on-bead digestion section and followed by labeling with a TMT-6plex and high pH reversed-phase fractionation (both described below).

TREX ZDHHC20 proteomics

TREX HEK293T cells were seeded and left overnight in an incubator at 37 °C in standard media supplemented with 1 μg ml−1 blasticidin and 50 μg ml−1 hygromycin B in quadruplicate. On the day before the treatment of cells with the appropriate probes, media were supplemented with 1 μg ml−1 of doxycycline or water. Cells were treated with 15 µM of C18-Bz in 0.5% FBS media for 8 h.

On-bead digestion

All samples were then dissolved in 1% SDS in PBS and then diluted to 0.2% SDS with PBS. Biotinylated proteins were then enriched on a 1:1 mixture of dimethylated NeutrAvidin agarose beads64 and control agarose beads (Thermo Fisher Scientific, 20333), which had been prewashed 2× 0.2% SDS PBS, for 3 h at room temperature. Beads were washed 3× with 1 ml SDS (0.2%) in PBS followed by 2× with 1 ml HEPES (50 mM, pH 7.4) and finally 1× with 1 ml HEPES (50 mM, pH 8.0). Beads were then suspended in 50 µl HEPES (50 mM, pH 8.0) with 400 ng of LysC (Promega, VA1170) for 2 h at 37 °C with agitation. The supernatant was removed and reduced with 5 mM TCEP and alkylated using 15 mM chloroacetamide for 15 min then digested with 100 ng of trypsin o/n at 37 °C (Promega).

Samples were acidified with 0.5% (vol/vol) TFA, and the solvent was removed in an Eppendorf Concentrator plus at 45 °C. Samples were dissolved in water containing 0.5% TFA and after stage tipping using Oasis HLB μElution Plate 30 μm following the manufacturer’s procedure, and elutions were dried in an Eppendorf Concentrator plus at 45 °C. Samples were dissolved in 2% MeCN, 97.9% water containing 0.1% TFA ready for LC–MS/MS analysis. Peptides were analyzed on a Q-Exactive mass spectrometer (Thermo Fisher Scientific) or an Eclipse mass spectrometer coupled to an Ultimate 3000 LC (Thermo Fisher Scientific) using an Easy Spray Nano-source. The instrument was operated in data-dependent acquisition mode selecting the ten most intense precursor ions for fragmentation.

Proteomics searches and data analysis for LFQ proteomics

RAW files were uploaded into MaxQuant (version 1.6.7.0) and searched against Uniprot curated human proteome (As of 2019) using the built-in Andromeda search engine. Cysteine carbamidomethylation was selected as a fixed modification and methionine oxidation and acetylation of protein N terminus as variable modifications. For site ID experiments, cysteine NEM modification and carbamidomethylation were selected as variable modifications. Trypsin/P was set as the digestion enzyme, up to two missed cleavages were allowed and a false discovery rate (FDR) of 0.01 was set for peptides, proteins and sites with match between runs selected. Data were quantified using LFQ with a minimum ratio count = 2.

Data analysis was performed using Perseus (version 1.6.2.1). MaxQuant proteingroups.txt output files were uploaded and filtered against contaminants, reverse and proteins identified by site. A base 2 logarithm was applied to all LFQ intensities. On-bead hydrolysis datasets were filtered to contain ≥3 valid values in the positive (mutant) condition. Missing values were imputed from a normal distribution (width = 0.3 and downshift = 1.8). YnPal KO samples data were filtered for valid values in at least 2/3 of each condition for all analyses except when comparing against palmitic acid, where only 2/3 YnPal-treated samples were considered and then missing values were imputed from a normal distribution (width = 0.3 and downshift = 1.8; Extended Data Fig. 7g). TREX samples were filtered for ≥3 valid values in the positive (mutant) condition with no imputation performed. Within the YnPal datasets, the data were normalized by subtracting the median value from each column. A two-tailed unpaired Student’s t test was performed comparing the various sets of condition groupings (S0 = 0.1/0.5, adjusted FDR = 0.01/0.05) for all proteins remaining in the dataset, and the results were analyzed according to their statistical significance.

TurboID proximity labeling

A total of 6 × 106cells stably expressing TurboGFP clones 1 and 2 and ZDHHC20 clones with C- or N-terminally fused TurboID were plated in duplicate in 10 cm dishes. After reaching 80% confluency, cells were treated with 500 μM biotin for 3 h, cooled on ice, collected and lysed in SDS lysis buffer (described above). A BCA assay was performed, and two 1 mg portions of each lysate (n = 4 independent biological replicates for each cell line) at 1 mg ml−1 were added to dimethylated neutravidin-agarose beads and agitated at room temperature for 3 h. Beads were washed 3× with 0.2% SDS HEPES (50 mM, pH 7.4) and 3× with HEPES (50 mM, pH 7.4). Beads were then suspended in 50 mM HEPES (pH 8.0) containing 400 ng LysC for 1 h at 37 °C. The supernatant was reduced with 5 mM TCEP and alkylated using 15 mM chloroacetamide for 15 min and then digested with 100 ng of trypsin o/n at 37 °C (Promega). Samples were then concentrated in an Eppendorf Concentrator plus at 45 °C for TMT-10Plex labeling and SCX fractionation.

TMT labeling

Samples were labeled with a TMT-6Plex or TMT-10Plex as described here24, and the combined solvent was removed in an Eppendorf Concentrator plus at 45 °C. Samples were then fractionated either using high pH reversed-phase fractionation (Pierce) following the manufacturer’s protocol or by SCX fractionation with the following method. Samples were redissolved in 1% TFA and loaded on pre-activated three layers of SCX membranes and fractionated six times. Membranes were washed 3× with 60 µl 0.2% TFA. Peptides were eluted using the following six elution buffers (60 µl): buffer 1 (75 mM ammonium formate, 20% (vol/vol) MeCN, 0.5% (vol/vol) formic acid), buffer 2 (125 mM ammonium formate, 20% (vol/vol) MeCN, 0.5% (vol/vol) formic acid), buffer 3 (200 mM ammonium formate, 20% (vol/vol) MeCN, 0.5% (vol/vol) formic acid), buffer 4 (300 mM ammonium formate, 20% (vol/vol) MeCN, 0.5% (vol/vol) formic acid), buffer 5 (400 mM ammonium formate, 20% (vol/vol) MeCN, 0.5% (vol/vol) formic acid) and buffer 6 (5% (vol/vol) ammonium hydroxide, 80% (vol/vol) MeCN). Samples were dried in an Eppendorf Concentrator plus at 45 °C and then dissolved in water containing 0.1% TFA, before analysis on a Q-Exactive mass spectrometer (Thermo Fisher Scientific) coupled to an Ultimate 3000 LC (Thermo Fisher Scientific) using an Easy Spray Nano-source. The instrument was operated in data-dependent acquisition mode selecting the ten most intense precursor ions for fragmentation.

TMT proteomic analysis

Data analysis was performed using Perseus (version 1.6.2.1). MaxQuant proteingroups.txt output files were uploaded and filtered against contaminants, reverse and proteins identified by site. A base 2 logarithm was applied to all reporter intensity corrected values, and data were filtered for where valid values were found in at least 8/10 or 5/6 channels. Data were normalized across all samples by subtracting the median across replicates within each TMT multiplex followed by normalizing across the conditions by subtracting the mean value from each column. A two-tailed unpaired Student’s t test was performed comparing the various sets of condition groupings (S0 = 0.1, adjusted FDR = 0.01) for all proteins remaining in the dataset, and the results were analyzed according to their statistical significance.

Generation of ZDHHC20 KO cell lines

Two guide sequences (gRNA1 and 2) targeting exon 9 or 4, respectively (Supplementary Table 8), were designed using the online tool CHOPCHOP (https://chopchop.cbu.uib.no)65 and separately cloned into a plasmid containing Cas9 and the sgRNA scaffold, pSpCas9(BB)-2A-Puro (PX459), using a Fast Digest BbsI restriction strategy coupled with T7 DNA ligase ligation. Plasmids were sequenced by GATC Biotech to confirm subcloning of the gRNA guides. In total, 1 μg of each plasmid was mixed with 250 μl of Opti-MEM before being combined with another mixture containing 5 μl of TransIT-X2 (5 µl per well) in 250 µl Opti-MEM. The combined mixtures were allowed to incubate at room temperature for 20 min before being added to a cell suspension containing 6 × 105 HEK293T cells in a six-well plate. The cells were cultured for 3 d before selection in 1 μg ml−1 puromycin for 1 week. Cells were then single-cell sorted into 96-well plates and allowed to expand into 12-well plates before screening by anti-ZDHHC20 and anti-calnexin (loading control) immunoblot. For single-cell sorting, see Molecular cloning.

Generation of ZDHHC20 T-REx cell lines

Flp-In T-REx 293 cells were transfected with 100 ng of pcDNA/FRT/C-FLAG-D20 WT or C-FLAG-D20(Y181G) alongside 0.9 μg of pOG44 plasmid using FuGene HD replacing with fresh media after 24 h. Cells were then grown for 4 d before selecting resistant clones in media containing 15 μg ml−1 blasticidin and 200 μg ml−1 hygromycin B over 10 d when resistant clones were pooled. Cells were then grown in standard media supplemented with 1 μg ml−1 blasticidin and 50 μg ml−1 hygromycin B for 14 d before colonies were pooled and expanded.

Bioinformatic PANTHER overrepresentation analysis

The online bioinformatic tool PANTHER66 was used to perform statistical overrepresentation analysis of ZDHHC20 substrates enriched in at least 2 of 3 cell lines, which are as follows: HEK293T, PANC1 and MDA-MB-231. Two separate analyses were performed using gene ontology (GO) terms cellular compartment and protein class. The cellular compartment (GO-Slim) analysis was performed using the default list of genes from the human genome, whereas the protein class analysis was done with a manually curated list representing the human S-acylated proteome. Statistical analysis and P values were determined using an FDR-adjusted two-tailed Fisher’s exact test. Results were filtered for those with a −log10(P value) > 9. The human S-acylome contains the combined unique hits between the following filtered SwissPalm lists: the first list was collated by setting the ‘nber_palmitoyl_proteome_hits’ and ‘nber_technique_categories’ ≥2 and the second list was generated by setting the ‘nber_palmitoyl_proteome_hits’ ≤1 and ‘nber_targeted_study_hits’ ≥1. After conversion of Uniprot AC IDs to gene names, the combined list of unique genes totaled 2,429. Results were filtered for those with a −log10(P value) > 1.5.

Generation of knock-in ZDHHC20(Y181G) mutant cell line by CRISPR–Cas9

To generate ZDHHC20 Y181G knock-in mutant polyclonal cell line, custom sgRNA and donor ssDNA were synthesized by Thermo Fisher Scientific (A35534), and recombinant Cas9 protein was used, following the manufacturer’s recommendations. In short, 4 × 105 HEK293T cells were seeded per well in a six-well plate a day before transfection. To transfect cells with an assembled ribonucleoprotein (RNP) complex, the following reagents were mixed: 6.25 μg of TrueCut Cas9 v2 protein (Thermo Fisher Scientific, A36496), 1.2 μg of sgRNA (5′-CACGAAAAGGCAAUAUAAUA-3′), 50 pmol of ssDNA (5′- AAATTCTTCCTGCTGTTTTTATTGTATTCCCTA[CTAGGTTGT]CTTTTCGTGGCTGCAACAGTTTTAGAGTACTT-3′, knock-in sequence in brackets), 12.5 μl of Lipofectamine Cas9 Plus Reagent and 7.5 μl of Lipofectamine CRISPRMAX Reagent (Thermo Fisher Scientific, CMAX00001) in 250 μl of Opti-MEM. The RNP mix was added to cells with 2.5 ml of fresh media and placed back in the incubator at 37 °C and 5% CO2. Two days after transfection, cells were trypsinized and seeded at 0.8 cells per well density on a 96-well plate to increase the probability of isolating single-cell clones. Cells were then placed back in the incubator, and 2 million cells from the remaining trypsinized cells were pelleted and flash frozen to be used as a control for downstream analyses. Three weeks after seeding the cells, wells that showed only one colony were further expanded in 24-well plates. When monoclonal populations reached 90% confluency, cells were trypsinized and half of them were frozen for storage. From the remaining cells, along with the transfected parental polyclonal cell population, genomic DNA (gDNA) was isolated using Monarch Genomic DNA Purification Kit (NEB, T3010S) following the manufacturer’s recommendations.

To assess if the Y181G sequence had successfully replaced the endogenous sequence in at least one allele, gDNA from each monoclonal cell line was probed by PCR with GoTaq G2 (Promega, M7841) using manufacturer recommendations and with the following program: 95 °C for 2 min for initial denaturation, 30 cycles of denaturation at 95 °C for 20 s, annealing at 55 °C for 30 s, extension at 72 °C for 1 min and final step of extension at 72 °C for 5 min. Forward primer 5′-TGTATTCCCTA [CTAGGTTGT]-3′ (knock-in sequence in brackets) and reverse primer 5′-CCCTATCTGTCCTCTGAT-3′ were used to produce an amplicon of 213 bp, which was resolved in a 2% agarose gel.

After selecting positive clones, a second PCR was carried out in these to confirm by Sanger sequencing that the Y181G mutation sequence had been successfully integrated and that the ORF of ZDHHC20 exon 7 was intact with no indels present. The PCR amplicon was produced using Q5 master mix (NEB, M0492S) and the following program: 98 °C for 30 s for initial denaturation, 33 cycles of denaturation at 98 °C for 10 s, annealing at 68 °C for 30 s, extension at 72 °C for 20 s and a final step of extension at 72 °C for 20 s. The primers used (forward 5′-GGCAGCCTCCATCCTACTTT-3′ and reverse 5′-GCCCTATCTGTCCTCTGATGG-3′) produced an amplicon of 348 bp, which was resolved in a 1.5% agarose gel, recovered using Monarch DNA gel extraction kit (NEB, T1020) following manufacturer’s recommendations and submitted to Genewiz for Sanger sequencing.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

>>> Read full article>>>
Copyright for syndicated content belongs to the linked Source : Nature.com – https://www.nature.com/articles/s41587-023-02030-0

Tags: palmitoylsciencetransferase
Previous Post

Engineered virus-like particles for transient delivery of prime editor ribonucleoprotein complexes in vivo

Next Post

Charles Oliveira vs. Arman Tsarukyan No. 1 contender fight set for UFC 300

Why Max Cady from ‘Cape Fear’ Continues to Haunt Audiences as a Timeless Nightmare

June 2, 2026

What to watch in primaries as Dems try to defend California – Spectrum News

June 2, 2026

Voyager Technologies CEO on acquisition of Astrobotic Technology, demand for space investment – CNBC

June 2, 2026

EA SPORTS™ College Football 27 Reveals Cover Athletes Celebrating Tomorrow’s Grid Iron Legends

June 2, 2026

Capitalism has warped our understanding of ecology and life’s origins – New Scientist

June 2, 2026

Propanc Biopharma’s CEO Attends Keynote Address on Aging Science at University of Granada Event – Quiver Quantitative

June 2, 2026

Trump Administration to Dismantle Ocean Monitoring System – The New York Times

June 2, 2026

Something Extra | Tuesday – Jamaica Gleaner

June 2, 2026

World Cup 2026: Switzerland Faces US Challenge Without Breel Embolo Over ESTA Issue

June 2, 2026

How Falling Oil Demand Could Transform Our Future

June 2, 2026

Categories

Archives

June 2026
M T W T F S S
1234567
891011121314
15161718192021
22232425262728
2930  
« May    
Earth-News.info

The Earth News is an independent English-language daily published Website from all around the World News

Browse by Category

  • Business (20,132)
  • Ecology (1,245)
  • Economy (1,268)
  • Entertainment (22,145)
  • General (21,866)
  • Health (10,301)
  • Lifestyle (1,278)
  • News (22,149)
  • People (1,269)
  • Politics (1,288)
  • Science (16,481)
  • Sports (21,765)
  • Technology (16,252)
  • World (1,258)

Recent News

Why Max Cady from ‘Cape Fear’ Continues to Haunt Audiences as a Timeless Nightmare

June 2, 2026

What to watch in primaries as Dems try to defend California – Spectrum News

June 2, 2026
  • About
  • Advertise
  • Privacy & Policy
  • Contact

© 2023 earth-news.info

No Result
View All Result

© 2023 earth-news.info

No Result
View All Result

© 2023 earth-news.info

Go to mobile version