* . *
  • About
  • Advertise
  • Privacy & Policy
  • Contact
Monday, May 11, 2026
Earth-News
  • Home
  • Business
  • Entertainment

    Lorraine Kelly Reveals Why Becoming a Grandmother Is the Greatest Joy of Her Life

    Discover the Ultimate Weekend Adventure in Tampa Bay

    Starz Entertainment Reports Bigger-Than-Expected Q1 Loss as Revenues Decline Year-Over-Year

    Smith Entertainment Group Unveils Bold Vision to Transform Delta Center into a Premier Dual-Sport Hub

    From Taylor Swift to the Oscars, 400-year-old ‘Hamlet’ flourishes in the age of TikTok – Audacy

    How Social Network Currency is Launching a Grad’s Career in Entertainment Journalism

  • General
  • Health
  • News

    Cracking the Code: Why China’s Economic Challenges Aren’t Shaking Markets, Unlike America’s” – Bloomberg

    Trump’s Narrow Window to Spread the Truth About Harris

    Trump’s Narrow Window to Spread the Truth About Harris

    Israel-Gaza war live updates: Hamas leader Ismail Haniyeh assassinated in Iran, group says

    Israel-Gaza war live updates: Hamas leader Ismail Haniyeh assassinated in Iran, group says

    PAP Boss to Niger Delta Youths, Stay Away from the Protest

    PAP Boss to Niger Delta Youths, Stay Away from the Protest

    Court Restricts Protests In Lagos To Freedom, Peace Park

    Court Restricts Protests In Lagos To Freedom, Peace Park

    Fans React to Jazz Jennings’ Inspiring Weight Loss Journey

    Fans React to Jazz Jennings’ Inspiring Weight Loss Journey

    Trending Tags

    • Trump Inauguration
    • United Stated
    • White House
    • Market Stories
    • Election Results
  • Science
  • Sports
  • Technology

    Has Silicon Motion Technology’s Stock Soared Too Far After a Stunning 368% Rally?

    Is SES AI Corporation the Game-Changing Battery Technology Stock You Need to Watch?

    SkyWater Technology Stockholders Approve Exciting Merger Agreement with IonQ

    KULR Technology Group to Host Q1 2026 Earnings Call on May 14 at 4:30 p.m. ET

    NCR Voyix Set to Dazzle at the 21st Annual Needham Technology, Media & Consumer Conference

    Danville High School’s Automotive Technology Classes Get a Boost with New Vehicle from Public School Foundation

    Trending Tags

    • Nintendo Switch
    • CES 2017
    • Playstation 4 Pro
    • Mark Zuckerberg
No Result
View All Result
  • Home
  • Business
  • Entertainment

    Lorraine Kelly Reveals Why Becoming a Grandmother Is the Greatest Joy of Her Life

    Discover the Ultimate Weekend Adventure in Tampa Bay

    Starz Entertainment Reports Bigger-Than-Expected Q1 Loss as Revenues Decline Year-Over-Year

    Smith Entertainment Group Unveils Bold Vision to Transform Delta Center into a Premier Dual-Sport Hub

    From Taylor Swift to the Oscars, 400-year-old ‘Hamlet’ flourishes in the age of TikTok – Audacy

    How Social Network Currency is Launching a Grad’s Career in Entertainment Journalism

  • General
  • Health
  • News

    Cracking the Code: Why China’s Economic Challenges Aren’t Shaking Markets, Unlike America’s” – Bloomberg

    Trump’s Narrow Window to Spread the Truth About Harris

    Trump’s Narrow Window to Spread the Truth About Harris

    Israel-Gaza war live updates: Hamas leader Ismail Haniyeh assassinated in Iran, group says

    Israel-Gaza war live updates: Hamas leader Ismail Haniyeh assassinated in Iran, group says

    PAP Boss to Niger Delta Youths, Stay Away from the Protest

    PAP Boss to Niger Delta Youths, Stay Away from the Protest

    Court Restricts Protests In Lagos To Freedom, Peace Park

    Court Restricts Protests In Lagos To Freedom, Peace Park

    Fans React to Jazz Jennings’ Inspiring Weight Loss Journey

    Fans React to Jazz Jennings’ Inspiring Weight Loss Journey

    Trending Tags

    • Trump Inauguration
    • United Stated
    • White House
    • Market Stories
    • Election Results
  • Science
  • Sports
  • Technology

    Has Silicon Motion Technology’s Stock Soared Too Far After a Stunning 368% Rally?

    Is SES AI Corporation the Game-Changing Battery Technology Stock You Need to Watch?

    SkyWater Technology Stockholders Approve Exciting Merger Agreement with IonQ

    KULR Technology Group to Host Q1 2026 Earnings Call on May 14 at 4:30 p.m. ET

    NCR Voyix Set to Dazzle at the 21st Annual Needham Technology, Media & Consumer Conference

    Danville High School’s Automotive Technology Classes Get a Boost with New Vehicle from Public School Foundation

    Trending Tags

    • Nintendo Switch
    • CES 2017
    • Playstation 4 Pro
    • Mark Zuckerberg
No Result
View All Result
Earth-News
No Result
View All Result
Home Science

Searching for data in DNA with CRISPR

March 19, 2024
in Science
Searching for data in DNA with CRISPR
Share on FacebookShare on Twitter

Searching for Data in DNA with CRISPR

The framework of a DNA data storage system with searching capability and the general workflow of SEEKER. a Complete framework of a searchable DNA data storage system includes writing, searching, and reading the data. b The oligo pool storing text data is separately constructed into two parts: reference strands and data strands. The reference strands usually comprise 100–200 oligos and can be pre-sequenced to determine the dictionary used to map the data strands to binary codes as well as the crRNA spacer sequence of an intended query; for instance, the keyword “courage” corresponds to the sequence “CTGTGCTAGCGTATGGCTCAT” in crRNA. The data strands are selectively amplified according to file IDs and then incubated with the Cas12a-crRNA ribonucleoprotein complex. The fluorescence intensity increases rapidly if the amplified file contains many repeats of the keyword “courage,” generating a strong fluorescence signal within a short time. If fewer instances of the keyword “courage” appear in the file, the fluorescence enhancement retards, and the endpoint fluorescence intensity becomes weaker. If the keyword “courage” is not found in the file, no fluorescence will be detected. After searching, files generating positive signals are recognized as carrying the data of interest and are subjected to next-generation sequencing to recover the complete content. In this example, a stronger signal is generated when the keyword “courage” appears twice, whereas a weaker signal is generated when the keyword only appears once. Illustrations were created with BioRender.com. Credit: Nature Communications (2024). DOI: 10.1038/s41467-024-46767-x

The digital age has led to the explosive growth of data of all kinds. Traditional methods for storing data—such as hard drives—are beginning to face challenges due to limited storage capacities. With the growing demand for data storage on the rise, alternate mediums of data storage are becoming increasingly popular—and necessary.

DNA is one of the emerging solutions to store data due to its physical density, data longevity, and data encryption ability. Any information that can be stored in a hard drive—such as texts, images, sounds, and movies—can also be converted into DNA sequences.

But while DNA is a promising solution to help meet the demand of data storage needs, performing a search within a strand of DNA can be cumbersome and difficult.

“Archiving information in synthetic DNA has emerged as an attractive solution to deal with the exploding growth of data in the modern world. However, quantitatively querying the data stored in DNA is still a challenge,” says Changchun Liu, professor in the Department of Biomedical Engineering at UConn Health.

In Nature Communications, Liu and a team of researchers discovered a way to simply and effectively search for data stored in DNA using a clustered, regularly interspaced short palindromic repeats (CRISPR) powered quantitative search engine.

In the paper, Liu introduces Search Enabled by Enzymatic Keyword Recognition (SEEKER), which utilizes CRISPR-Cas12a to identify the keyword in files stored in DNA quantitatively.

“DNA is a promising medium for data storage because of its stability and high information density. Theoretically, one gram of DNA can store 215 petabytes of data, the data size of about 100 million movies. Like a hard drive that stores information in binary data bits, DNA stores information in sequences of four nucleobases—adenine (A), thymine (T), cytosine (C), and guanine (G).

“The developments in DNA synthesis technology and next-generation sequencing are turning DNA data storage into reality,” explains Jiongyu Zhang, a graduate student in Liu’s lab and first author of the paper.

Liu utilized his expertise in CRISPR technology to help come up with a better solution to search within a strand of DNA.

CRISPR is an acquired immune mechanism that can identify a specific infectious DNA sequence in a cell overwhelmed with interfering genes, similar to a keyword search in a database.

SEEKER, utilizing CRISPR, rapidly generates visible fluorescence, or light, when a DNA target corresponding to the keyword of interest is present. SEEKER is able to successfully perform quantitative text searching since the growth rate of the fluorescence intensity is proportional to the keyword frequency.

In the paper, the researchers successfully identified keywords in 40 files with a background of approximately 8,000 irrelevant terms.

“Overall, the SEEKER provides a quantitative approach to conducting parallel searching-including metadata search—over the complete content stored in DNA with simple implementation and rapid result generation,” explains Liu.

More information:
Jiongyu Zhang et al, CRISPR-powered quantitative keyword search engine in DNA data storage, Nature Communications (2024). DOI: 10.1038/s41467-024-46767-x

Citation:
Searching for data in DNA with CRISPR (2024, March 19)
retrieved 19 March 2024
from https://phys.org/news/2024-03-dna-crispr.html

This document is subject to copyright. Apart from any fair dealing for the purpose of private study or research, no
part may be reproduced without the written permission. The content is provided for information purposes only.

>>> Read full article>>>
Copyright for syndicated content belongs to the linked Source : Phys.org – https://phys.org/news/2024-03-dna-crispr.html

Tags: CRISPRsciencesearching
Previous Post

Cellulose fibers are emerging as a sustainable option for wrapping everything from foods to electronics

Next Post

Female mosquitoes rely on one another to choose the best breeding sites, and they’re already on the hunt

Vatican releases document on integral ecology within the family – Vatican News

May 11, 2026

Major Grant Boosts Efforts to Save Endangered Sunflower Sea Stars and Protect Bay Area Coastline

May 11, 2026

Mysterious Water Discovered in Interstellar Comet 3I/ATLAS Unlike Anything Seen Before

May 11, 2026

Texas Baseball Faces Challenges: Breaking Down Team Strength and Roster After Tough Tennessee Series

May 11, 2026

Bose Unveils a Revolutionary Modular Home Audio System, Reviving Its Iconic Lifestyle Lineup

May 11, 2026

GOLD FOR SANDERS AND SUZUKI – World Climbing

May 11, 2026

Understanding the K-Shaped Economy: What It Means for Financial Markets Today

May 11, 2026

Lorraine Kelly Reveals Why Becoming a Grandmother Is the Greatest Joy of Her Life

May 11, 2026

Tamil Nadu: How Vijay’s TVK used social media for election success – BBC

May 11, 2026

Has Silicon Motion Technology’s Stock Soared Too Far After a Stunning 368% Rally?

May 11, 2026

Categories

Archives

May 2026
M T W T F S S
 123
45678910
11121314151617
18192021222324
25262728293031
« Apr    
Earth-News.info

The Earth News is an independent English-language daily published Website from all around the World News

Browse by Category

  • Business (20,132)
  • Ecology (1,210)
  • Economy (1,230)
  • Entertainment (22,107)
  • General (21,449)
  • Health (10,264)
  • Lifestyle (1,242)
  • News (22,149)
  • People (1,232)
  • Politics (1,250)
  • Science (16,445)
  • Sports (21,728)
  • Technology (16,214)
  • World (1,221)

Recent News

Vatican releases document on integral ecology within the family – Vatican News

May 11, 2026

Major Grant Boosts Efforts to Save Endangered Sunflower Sea Stars and Protect Bay Area Coastline

May 11, 2026
  • About
  • Advertise
  • Privacy & Policy
  • Contact

© 2023 earth-news.info

No Result
View All Result

© 2023 earth-news.info

No Result
View All Result

© 2023 earth-news.info

Go to mobile version